Informations

Comprendre les adaptateurs Illumina

Comprendre les adaptateurs Illumina



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Je travaille actuellement sur un projet où je dois couper les adaptateurs de certaines données RNA-Seq à lecture unique, et je veux savoir quelles séquences cliver. Des adaptateurs Illumina TruSeq ont été utilisés. J'ai essayé de suivre l'explication de Tuft et de donner un sens à la vidéo d'Illumina, mais il me reste plusieurs questions non résolues.

L'adaptateur universel TruSeq semble être ce qui se lie à la cellule à écoulement et est

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

L'indice N de l'adaptateur TruSeq est

GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-NNNNNN-ATCTCGTATGCCGTCTTCTGCTTG

Mon impression de la façon dont le fragment d'ADNc attaché aux adaptateurs est :

(cellule à écoulement) || || || (Adaptateur d'index) (Adaptateur universel) || 3' 5' 3' 5' || GTTCGTCTTCTGCCGTATGCTCTA-NNNNNN-CACTGACCTCAAGTCTGCACACGAGAAGGCTAGA TCTAGCCTTCTCGCAGCACATCCCTTTCTCACATCTAGAGCCACCAGCGGCATAGTAA || ||||||||||||||| ||||||||||||||| <----- Doit se dénaturer ! || 5' AATGATCGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT--(5' MON FRAGMENT D'ADN 3')--AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC‐NNNNNN‐ATCTCGTATGCCGTCTTCTGCTTG ||----GC---------TTGGCTAG 3'CC| || ^(Flow cell oligo) ^(Adaptateur universel) ^(Adaptateur d'index) || || TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGTG || || ^(Lire 1 amorce) ^(Lire 2 amorce) || || || TAGAGCATACGGCAGAAGACGAAC----------|| || || ^(Oligo de cellules de flux) ||

Voici mes questions :

  1. Cette image est-elle correcte dans le cas simple brin ?

  2. Ai-je le bon site de liaison d'amorce (utilisé pour le séquençage réel) ?

  3. Ai-je le bon oligo pour les lectures de fin appariées, c'est-à-direTAGAGCATACGGCAGAAGACGAAC ---------?

  4. Ai-je la bonne amorce (et son site) pour la lecture de l'index ?

Par Illumina, je suppose que je dois inclure ceci : "Séquences oligonucléotidiques © 2007-2013 Illumina, Inc. Tous droits réservés. Les œuvres dérivées créées par les clients d'Illumina sont autorisées pour une utilisation avec les instruments et produits Illumina uniquement. Toutes les autres utilisations sont strictement interdites. "


Séquençage de teinture Illumina

La plateforme de séquençage Illumina (anciennement connue sous le nom de Solexa) est basée sur la méthode de « terminaison réversible cyclique » décrite dans Bentley et al. (2008). Les bibliothèques d'ADN préparées par fragmentation aléatoire et liées à des adaptateurs sont immobilisées sur une surface solide appelée « flowcell ». Les Flowcells sont composées de huit canaux, ou voies, qui sont densément recouverts d'une « pelouse » d'amorces liées de manière covalente complémentaires aux adaptateurs 5′ et 3′. Chaque piste peut être chargée avec une bibliothèque distincte, soit constituée d'un seul échantillon, soit plus communément pour les bactéries, des bibliothèques multiplexées contenant jusqu'à 96 bibliothèques indexées. Les fragments d'ADN se ligaturent aux amorces de la Flow Cell, où ils sont amplifiés in situ par le processus de PCR en phase solide, également connu sous le nom d'amplification en pont, qui crée des copies identiques de chaque molécule modèle unique à proximité (clusters). Ce processus peut produire jusqu'à 10 millions de clusters à base de molécule unique dans chaque canal de la cellule à écoulement ( Mardis, 2008 Shendure & Ji, 2008 ), qui sont ensuite tous séquencés simultanément.

Au cours de chaque cycle de séquençage, un seul désoxynucléoside triphosphate (dNTP) marqué est ajouté à la chaîne d'acide nucléique. Le nucléotide sert également de terminateur pour la polymérisation, donc après chaque cycle d'incorporation de dNTP, le colorant fluorescent est imagé pour identifier la base, puis clivé avec la modification de terminaison pour permettre l'incorporation du nucléotide suivant ( Bentley et al., 2008 ) . Étant donné que les quatre dNTP liés à un terminateur réversible (A, C, T, G) sont présents sous forme de molécules uniques et séparées, la compétition naturelle diminue les chances qu'un nucléotide soit incorporé plus que les autres. Les appels de base sont effectués directement à partir des mesures d'intensité du signal au cours de chaque cycle. Après chaque cycle, les étiquettes sont retirées et cela permet le prochain niveau d'incorporation ( Turcatti, Romieu, Fedurco, & Tairi, 2008 ). Le séquençage Illumina est devenu la plateforme la plus réussie commercialement ( Metzker, 2010 Shendure et al., 2011 ), produisant des lectures jusqu'à 125 pb sur les machines Hiseq utilisant la chimie SBS v4, ou 300 pb sur la Miseq, selon le nombre de cycles. Le taux d'erreur de substitution est généralement d'environ 1% ou moins, avec peu de faux indels.

Le multiplexage de 96 échantillons par piste ou de 768 échantillons par Flow Cell a permis d'augmenter le débit des séquences bactériennes. Les méthodes de préparation de bibliothèques peuvent être modifiées pour effectuer un séquençage à extrémités appariées, c'est-à-dire la génération de lectures de séquences à partir des deux extrémités des fragments d'ADN matrice en utilisant deux ensembles d'amorces de séquençage (Roach, Boysen, Wang, & Hood, 1995). L'Illumina Hiseq 2500 génère jusqu'à 1000 Go de bases par analyse, avec un nombre de lecture maximal de 4000 M et une longueur de lecture maximale de 2 × 125 pb. Le Miseq, un instrument à débit plus faible et plus rapide destiné aux petits laboratoires et aux diagnostics cliniques a également été lancé en 2011. Le Miseq a une sortie maximale de 15 Go, un nombre de lecture de 25 M et une longueur de lecture allant jusqu'à 2 × 300 pb. En 2014, Illumina a lancé le Nextseq 500, un séquenceur de bureau doté des capacités d'un Hiseq ou d'un Miseq. Le Nextseq 500 est actuellement capable de fournir jusqu'à 120 Go de puissance totale, un nombre de lectures de 400 M et 2 × 150 bp ( http://www.illumina.com/systems.ilmn ).


Séquençage ADN

La technologie de séquençage de nouvelle génération (NGS) d'Illumina utilise la chimie de l'amplification clonale et du séquençage par synthèse (SBS) pour permettre un séquençage rapide et précis. Le processus identifie simultanément les bases d'ADN tout en les incorporant dans une chaîne d'acide nucléique. Chaque base émet un signal fluorescent unique lorsqu'elle est ajoutée au brin en croissance, qui est utilisé pour déterminer l'ordre de la séquence d'ADN.

La technologie NGS peut être utilisée pour séquencer l'ADN de n'importe quel organisme, fournissant des informations précieuses en réponse à presque toutes les questions biologiques. Une technologie hautement évolutive, le séquençage de l'ADN peut être appliqué à de petites régions ciblées ou à l'ensemble du génome grâce à une variété de méthodes, permettant aux chercheurs d'enquêter et de mieux comprendre la santé et la maladie.

Une décennie de séquençage

Explorez les percées, les avancées et les progrès.

Avantages du séquençage de l'ADN avec NGS

  • Séquençage de grandes étendues d'ADN de manière massivement parallèle, offrant des avantages en termes de débit et d'échelle par rapport au séquençage de Sanger basé sur l'électrophorèse capillaire
  • Fournit une haute résolution pour obtenir une vue base par base d'un gène, d'un exome ou d'un génome
  • Fournit des mesures quantitatives basées sur l'intensité du signal
  • Détecte pratiquement tous les types d'altérations de l'ADN génomique, y compris les variantes nucléotidiques uniques, les insertions et les suppressions, les changements de nombre de copies et les aberrations chromosomiques
  • Offre un débit et une flexibilité élevés pour mettre à l'échelle les études et séquencer plusieurs échantillons simultanément
Séquenceurs d'ADN de paillasse

Comparez la vitesse et le débit des systèmes de séquençage d'ADN Illumina pour trouver la meilleure option pour votre laboratoire.

Méthodes courantes de séquençage de l'ADN

Séquençage du génome entier

Le séquençage du génome entier est la méthode la plus complète pour analyser le génome. La baisse rapide des coûts de séquençage et la possibilité d'obtenir des informations précieuses sur l'ensemble du code génétique font de cette méthode un puissant outil de recherche.

Reséquençage ciblé

Avec le reséquençage ciblé, un sous-ensemble de gènes ou de régions du génome est isolé et séquencé, ce qui permet aux chercheurs de concentrer leur temps, leurs dépenses et leur analyse sur des domaines d'intérêt spécifiques.

Séquençage de puces

En combinant les tests d'immunoprécipitation de la chromatine (ChIP) et le séquençage, le séquençage ChIP (ChIP-Seq) est une méthode puissante pour identifier les sites de liaison à l'ADN à l'échelle du génome pour les facteurs de transcription et d'autres protéines.

Préparation de la bibliothèque pour le séquençage de l'ADN

Notre portefeuille polyvalent de préparation de bibliothèques vous permet d'examiner de petites régions ciblées ou l'ensemble du génome. Nous avons innové dans la technologie de fragmentation sans PCR et sur billes, offrant des gains de temps, de la flexibilité et des performances de séquençage accrues des données.

Examen des méthodes de séquençage de l'ADN

Cette collection de publications évaluées par des pairs contient des avantages et des inconvénients, des diagrammes de protocoles schématiques et des références connexes pour diverses méthodes de séquençage de l'ADN.

Solutions associées

Séquençage de l'ADN du cancer

Les méthodes de séquençage basées sur le NGS permettent aux chercheurs sur le cancer de détecter des variantes somatiques rares, d'effectuer des comparaisons tumorales normales et d'analyser des fragments d'ADN en circulation. En savoir plus sur le séquençage du cancer.

Solutions de génotypage

Les technologies de génotypage basées sur le séquençage et les puces peuvent donner un aperçu des conséquences fonctionnelles de la variation génétique. En savoir plus sur le génotypage.

Technologie d'ADN sans cellules

Les ADN acellulaires (cfDNA) sont de courts fragments d'ADN libérés dans la circulation sanguine. Le cfDNA d'un échantillon de sang maternel peut être utilisé pour dépister des affections chromosomiques courantes chez le fœtus. En savoir plus sur la technologie de l'ADN sans cellule.

Séquençage microbien

L'analyse des espèces microbiennes à l'aide du séquençage de l'ADN peut éclairer les études de métagénomique environnementale, la surveillance des maladies infectieuses, l'épidémiologie moléculaire, etc. En savoir plus sur les méthodes de séquençage microbien.

Vous souhaitez recevoir des newsletters, des études de cas et des informations sur les techniques d'analyse génomique ? Entrez votre adresse email.

Ressources additionnelles

Technologie NGS

Le NGS est devenu un outil de recherche quotidien utilisé pour répondre aux questions biologiques complexes d'aujourd'hui.

Gene Panel et Array Finder

Identifiez les panels de séquençage ou les puces à ADN qui ciblent vos gènes d'intérêt.

Analyse des données de séquençage de l'ADN

Trouvez des outils d'analyse intuitifs qui transforment les données brutes de séquençage de l'ADN en résultats significatifs.

Conseils de dépannage de séquençage

Ces courtes vidéos fournissent des conseils d'experts sur des problèmes tels que l'overclustering, la quantification incohérente et le séquençage à travers l'insert.

Guide des méthodes

Toutes les informations dont vous avez besoin, des puces BeadChips à la préparation de la bibliothèque en passant par la sélection et l'analyse du séquenceur. Sélectionnez les meilleurs outils pour votre laboratoire.

Trouvez le bon kit

Déterminez le meilleur kit ou tableau de préparation de bibliothèque pour vos besoins en fonction de votre matériel de départ et de la méthode d'intérêt.

Technologies innovantes

Chez Illumina, notre objectif est d'appliquer des technologies innovantes à l'analyse de la variation et de la fonction génétiques, rendant possibles des études qui n'étaient même pas imaginables il y a quelques années à peine. Il est essentiel pour nous de fournir des solutions innovantes, flexibles et évolutives pour répondre aux besoins de nos clients. En tant qu'entreprise mondiale qui accorde une grande valeur aux interactions collaboratives, à la livraison rapide de solutions et au plus haut niveau de qualité, nous nous efforçons de relever ce défi. Les technologies innovantes de séquençage et de matrice d'Illumina alimentent des avancées révolutionnaires dans la recherche en sciences de la vie, la génomique translationnelle et grand public et le diagnostic moléculaire.

Pour la recherche uniquement. Ne pas utiliser dans les procédures de diagnostic (sauf indication contraire).


Comprendre les adaptateurs Illumina - Biologie

Les pipelines de génération de fichiers Illumina FASTQ incluent une option de découpage d'adaptateur pour la suppression des séquences d'adaptateur des extrémités 3' des lectures. Les séquences d'adaptateur doivent être supprimées des lectures car elles interfèrent avec les analyses en aval, telles que l'alignement des lectures sur une référence. Les adaptateurs contiennent les sites de liaison des amorces de séquençage, les séquences d'index et les sites qui permettent aux fragments de bibliothèque de se fixer au tapis de cellules d'écoulement. Les bibliothèques préparées avec les kits de préparation de bibliothèque Illumina nécessitent un rognage d'adaptateur uniquement aux extrémités 3' des lectures, car les séquences d'adaptateur ne se trouvent pas aux extrémités 5'.

Noter: Les bibliothèques préparées avec le kit de préparation de bibliothèque Nextera™ Mate Pair sont une exception, et les directives pour le découpage des adaptateurs de ces bibliothèques peuvent être trouvées dans la note technique Traitement des données des lectures de paires Nextera Mate sur les plates-formes de séquençage Illumina.

Pour comprendre pourquoi les séquences adaptatrices ne se trouvent qu'aux extrémités 3' des lectures, il est d'abord utile de comprendre où les amorces de séquençage s'hybrident au modèle de bibliothèque sur une Flow Cell. Les diagrammes ci-dessous montrent les sites d'hybridation des amorces à chaque étape de l'analyse de séquençage : lecture 1, index 1, index 2 et lecture 2.

Figure 1. Cellule à flux appariée pour réactifs MiSeq™, HiSeq™ 1000/1500/2000/2500 et NovaSeq™ 6000 v1.0

Figure 2. iSeq™ 100, MiniSeq™, NextSeq™ 500/550, NextSeq 1000/2000, HiSeq 3000/4000 Flow Cell et réactifs NovaSeq 6000 v1.5

Comme le montrent les figures 1 et 2, dans les deux lectures 1 et 2, l'amorce de séquençage s'hybride à l'adaptateur, immédiatement en amont de l'insert d'ADN (en gris). Étant donné que le séquençage commence à la première base de l'insert d'ADN dans les lectures 1 et 2, l'adaptateur n'est pas séquencé au début de la lecture. Cependant, si le séquençage s'étend au-delà de la longueur de l'insert d'ADN et dans l'adaptateur à l'extrémité opposée du fragment de bibliothèque, cette séquence d'adaptateur se trouvera à l'extrémité 3' de la lecture. Par conséquent, les lectures nécessitent un ajustement de l'adaptateur uniquement sur leurs extrémités 3'.


Contre-attaque

Illumina semble changer de vitesse face à la concurrence croissante. Pour répondre aux problèmes de prix, Illumina a investi dans de nouvelles innovations permettant de réduire les coûts et expédie une nouvelle gamme de séquenceurs ciblée à 600 $ par génome avec une feuille de route pour atteindre 100 $ par génome. La feuille de route appelle également à un investissement accru dans l'intelligence artificielle (IA) et à un soutien aux "multi-omiques" de pointe, qui utilisent un séquençage avancé pour créer une compréhension plus complète de la biologie sous-jacente à la santé et aux maladies humaines.

L'approche revitalisée semble porter ses fruits. Lors de la conférence téléphonique d'Illumina au premier trimestre, le PDG Francis deSouza a signalé que les commandes avaient atteint un niveau record, la société progressant également dans la pénétration de nouveaux marchés et le remboursement des traitements génomiques. Pour l'exercice 2021, Illumina s'attend à une croissance des revenus d'une année sur l'autre de l'ordre de 25 % à 28 %, avec un bénéfice par action dilué selon les PCGR de 4,72 $ à 4,97 $ et un bénéfice par action diluée non conforme aux PCGR de 5,80 $ à 6,05 $.


Séquençage ADN

La technologie de séquençage de nouvelle génération (NGS) d'Illumina utilise la chimie de l'amplification clonale et du séquençage par synthèse (SBS) pour permettre un séquençage rapide et précis. Le processus identifie simultanément les bases d'ADN tout en les incorporant dans une chaîne d'acide nucléique. Chaque base émet un signal fluorescent unique lorsqu'elle est ajoutée au brin en croissance, qui est utilisé pour déterminer l'ordre de la séquence d'ADN.

La technologie NGS peut être utilisée pour séquencer l'ADN de n'importe quel organisme, fournissant des informations précieuses en réponse à presque toutes les questions biologiques. Une technologie hautement évolutive, le séquençage de l'ADN peut être appliqué à de petites régions ciblées ou à l'ensemble du génome grâce à une variété de méthodes, permettant aux chercheurs d'enquêter et de mieux comprendre la santé et la maladie.

Une décennie de séquençage

Explorez les percées, les avancées et les progrès.

Avantages du séquençage de l'ADN avec NGS

  • Séquençage de grandes étendues d'ADN de manière massivement parallèle, offrant des avantages en termes de débit et d'échelle par rapport au séquençage de Sanger basé sur l'électrophorèse capillaire
  • Fournit une haute résolution pour obtenir une vue base par base d'un gène, d'un exome ou d'un génome
  • Fournit des mesures quantitatives basées sur l'intensité du signal
  • Détecte pratiquement tous les types d'altérations de l'ADN génomique, y compris les variantes nucléotidiques uniques, les insertions et les suppressions, les changements de nombre de copies et les aberrations chromosomiques
  • Offre un débit et une flexibilité élevés pour mettre à l'échelle les études et séquencer plusieurs échantillons simultanément
Séquenceurs d'ADN de paillasse

Comparez la vitesse et le débit des systèmes de séquençage d'ADN Illumina pour trouver la meilleure option pour votre laboratoire.

Méthodes courantes de séquençage de l'ADN

Séquençage du génome entier

Le séquençage du génome entier est la méthode la plus complète pour analyser le génome. La baisse rapide des coûts de séquençage et la possibilité d'obtenir des informations précieuses sur l'ensemble du code génétique font de cette méthode un puissant outil de recherche.

Reséquençage ciblé

Avec le reséquençage ciblé, un sous-ensemble de gènes ou de régions du génome est isolé et séquencé, ce qui permet aux chercheurs de concentrer leur temps, leurs dépenses et leur analyse sur des domaines d'intérêt spécifiques.

Séquençage de puces

En combinant les tests d'immunoprécipitation de la chromatine (ChIP) et le séquençage, le séquençage ChIP (ChIP-Seq) est une méthode puissante pour identifier les sites de liaison à l'ADN à l'échelle du génome pour les facteurs de transcription et d'autres protéines.

Préparation de la bibliothèque pour le séquençage de l'ADN

Notre portefeuille polyvalent de préparation de bibliothèques vous permet d'examiner de petites régions ciblées ou l'ensemble du génome. Nous avons innové dans la technologie de fragmentation sans PCR et sur billes, offrant des gains de temps, de la flexibilité et des performances de séquençage accrues des données.

Examen des méthodes de séquençage de l'ADN

Cette collection de publications évaluées par des pairs contient des avantages et des inconvénients, des diagrammes de protocoles schématiques et des références connexes pour diverses méthodes de séquençage de l'ADN.

Solutions associées

Séquençage de l'ADN du cancer

Les méthodes de séquençage basées sur le NGS permettent aux chercheurs sur le cancer de détecter des variantes somatiques rares, d'effectuer des comparaisons tumorales normales et d'analyser des fragments d'ADN en circulation. En savoir plus sur le séquençage du cancer.

Solutions de génotypage

Les technologies de génotypage basées sur le séquençage et les puces peuvent donner un aperçu des conséquences fonctionnelles de la variation génétique. En savoir plus sur le génotypage.

Découverte de variante causale

Les technologies de séquençage de l'ADN à haut débit permettent aux chercheurs de dépister rapidement de grands nombres d'échantillons pour trouver des variantes causales associées à des maladies complexes. En savoir plus sur la découverte de variante causale.

Séquençage microbien

L'analyse des espèces microbiennes à l'aide du séquençage de l'ADN peut éclairer les études de métagénomique environnementale, la surveillance des maladies infectieuses, l'épidémiologie moléculaire, etc. En savoir plus sur les méthodes de séquençage microbien.

Vous souhaitez recevoir des newsletters, des études de cas et des informations sur les techniques d'analyse génomique ? Entrez votre adresse email.

Ressources additionnelles

Technologie NGS

Le NGS est devenu un outil de recherche quotidien utilisé pour répondre aux questions biologiques complexes d'aujourd'hui.

Analyse des données de séquençage de l'ADN

Trouvez des outils d'analyse intuitifs qui transforment les données brutes de séquençage de l'ADN en résultats significatifs.

Conseils de dépannage de séquençage

Ces courtes vidéos fournissent des conseils d'experts sur des problèmes tels que l'overclustering, la quantification incohérente et le séquençage à travers l'insert.

Avoir un impact avec plusieurs méthodes

Visitez notre centre de contenu pour découvrir comment la combinaison du séquençage de l'ADN avec d'autres méthodes génomiques peut conduire à des percées.

Technologies innovantes

Chez Illumina, notre objectif est d'appliquer des technologies innovantes à l'analyse de la variation et de la fonction génétiques, rendant possibles des études qui n'étaient même pas imaginables il y a quelques années à peine. Il est essentiel pour nous de fournir des solutions innovantes, flexibles et évolutives pour répondre aux besoins de nos clients. En tant qu'entreprise mondiale qui accorde une grande valeur aux interactions collaboratives, à la livraison rapide de solutions et au plus haut niveau de qualité, nous nous efforçons de relever ce défi. Les technologies innovantes de séquençage et de matrice d'Illumina alimentent des avancées révolutionnaires dans la recherche en sciences de la vie, la génomique translationnelle et grand public et le diagnostic moléculaire.


Comprendre les adaptateurs Illumina - Biologie

La technologie de séquençage Illumina utilise la chimie de génération et de séquençage de clusters par synthèse (SBS) pour séquencer des millions ou des milliards de clusters sur une Flow Cell, selon la plate-forme de séquençage. Au cours de la chimie SBS, pour chaque cluster, des appels de base sont effectués et stockés pour chaque cycle de séquençage par le logiciel d'analyse en temps réel (RTA) sur l'instrument. RTA stocke les données d'appel de base sous la forme de fichiers d'appel de base individuels (ou BCL). Une fois le séquençage terminé, les appels de base dans les fichiers BCL doivent être convertis en données de séquence. Ce processus est appelé conversion BCL en FASTQ.

Un fichier FASTQ est un fichier texte qui contient les données de séquence des clusters qui passent le filtre sur une Flow Cell (pour plus d'informations sur les clusters qui passent le filtre, voir la section « informations supplémentaires » de ce bulletin). Si les échantillons ont été multiplexés, la première étape de la génération de fichiers FASTQ est démultiplexage. Le démultiplexage attribue des clusters à un échantillon, en fonction de la ou des séquences d'index du cluster. Après démultiplexage, les séquences assemblées sont écrites dans des fichiers FASTQ par échantillon. Si les échantillons n'ont pas été multiplexés, l'étape de démultiplexage n'a pas lieu et, pour chaque couloir de Flow Cell, tous les clusters sont affectés à un seul échantillon.

Pour une analyse à lecture unique, un fichier FASTQ de lecture 1 (R1) est créé pour chaque échantillon par ligne de Flow Cell. Pour une analyse appariée, un fichier FASTQ R1 et un fichier Read 2 (R2) sont créés pour chaque échantillon pour chaque voie. Les fichiers FASTQ sont compressés et créés avec l'extension *.fastq.gz.

A quoi ressemble un fichier FASTQ ?

Pour chaque cluster qui passe le filtre, une seule séquence est écrite dans le fichier R1 FASTQ de l'échantillon correspondant, et, pour une exécution appariée, une seule séquence est également écrite dans le fichier R2 FASTQ de l'échantillon. Chaque entrée dans un fichier FASTQ se compose de 4 lignes :

  1. Un identifiant de séquence avec des informations sur l'exécution de séquençage et le cluster. Le contenu exact de cette ligne varie en fonction du logiciel de conversion BCL vers FASTQ utilisé.
  2. La séquence (la base appelle A, C, T, G et N).
  3. Un séparateur, qui est simplement un signe plus (+).
  4. Les scores de qualité d'appel de base. Ceux-ci sont codés Phred +33, utilisant des caractères ASCII pour représenter les scores de qualité numériques.

Voici un exemple d'une seule entrée dans un fichier R1 FASTQ :

Des informations plus détaillées sur le format de fichier de séquence FASTQ sont disponibles ici.

Comment visualiser un fichier FASTQ

Les fichiers FASTQ peuvent contenir jusqu'à des millions d'entrées et peuvent avoir une taille de plusieurs mégaoctets ou gigaoctets, ce qui les rend souvent trop volumineux pour être ouverts dans un éditeur de texte normal. En règle générale, il n'est pas nécessaire de visualiser les fichiers FASTQ, car ce sont des fichiers de sortie intermédiaires utilisés comme entrée pour les outils qui effectuent une analyse en aval, comme l'alignement sur une référence ou un assemblage de novo.

Si vous devez afficher un fichier FASTQ à des fins de dépannage ou par curiosité, vous aurez besoin soit d'un éditeur de texte capable de gérer de très gros fichiers, soit d'un accès à un système Unix ou Linux où les gros fichiers peuvent être consultés via la ligne de commande.

Comment générer des fichiers FASTQ

La génération de fichiers FASTQ est la première étape de tous les workflows d'analyse utilisés par MiSeq Reporter sur MiSeq et Local Run Manager sur MiniSeq. Une fois l'analyse terminée, les fichiers FASTQ se trouvent dans le dossier <run>DataIntensitiesBaseCalls sur le MiSeq et dans le dossier <output>Alignment_#<subfolder>Fastq sur le MiniSeq.

Pour toutes les analyses téléchargées sur BaseSpace Sequence Hub, la génération de fichier FASTQ se produit automatiquement une fois l'analyse complètement téléchargée, et les fichiers FASTQ sont utilisés comme entrée pour les différentes applications d'analyse sur BaseSpace Sequence Hub. Sur BaseSpace Sequence Hub, vous pouvez trouver vos fichiers FASTQ dans le(s) projet(s) associé(s) à votre exécution.

Le logiciel de conversion bcl2fastq peut être utilisé pour générer des fichiers FASTQ à partir des données générées sur tous les systèmes de séquençage Illumina actuels.

Pour plus d'informations sur les différents paramètres pouvant être appliqués lors de la génération de fichiers FASTQ, consultez les guides d'utilisation du logiciel ci-dessous.


Comprendre les adaptateurs Illumina - Biologie

Les kits d'enrichissement Illumina (basés sur l'ADN et l'ARN) aident à isoler et à enrichir des régions d'intérêt spécifiques dans un génome ou un transcriptome pour le séquençage. Par exemple, Illumina DNA Prep with Enrichment (anciennement connu sous le nom de Nextera Flex for Enrichment) avec le TruSight Cancer Panel cible 94 gènes et 284 SNP associés à divers cancers.

Ce bulletin décrit les principes d'une réaction d'enrichissement et la terminologie couramment utilisée pour décrire les kits d'enrichissement Illumina.

Avec les kits d'enrichissement, « Réaction » (en abrégé « rxn ») fait référence au nombre de réactions d'enrichissement fournies avec le kit. La « plexité » (en abrégé « plex ») fait référence au nombre de bibliothèques pré-enrichies qui sont regroupées dans une réaction d'enrichissement. Par exemple, un kit 8-rxn x 12-plex contient suffisamment de réactifs pour effectuer huit enrichissements. Dans chaque réaction d'enrichissement, 12 bibliothèques peuvent être regroupées. Par conséquent, le nombre total d'échantillons pouvant être préparés avec ce kit est de 96 échantillons. La figure suivante illustre comment trois bibliothèques sont regroupées dans une réaction d'enrichissement.

Dans cette illustration, les trois bibliothèques pré-enrichies sont préparées puis regroupées en quantités égales (en masse) pour l'hybridation avec des sondes d'enrichissement spécifiques à la cible (pooling 3-plex). Ces fragments liés à la sonde sont ensuite capturés avec des billes de streptavidine. Tous les fragments non liés sont éliminés par lavage et les fragments liés, enrichis pour les séquences d'intérêt, seront élués des billes de streptavidine et séquencés.

Kits d'enrichissement d'ADN – fragmentation enzymatique de l'ADN

Illumina DNA Prep with Enrichment (anciennement Nextera Flex for Enrichment) est basé sur la fragmentation enzymatique de l'ADN avec une enzyme transposome. Les panneaux de sondes suivants sont utilisés avec Illumina DNA Prep with Enrichment :


Construction de la bibliothèque NGS

À mesure que la production de séquençage augmente et que les échelles expérimentales augmentent, la génération de bibliothèques pour le séquençage est souvent l'étape limitant le débit. Nous sommes heureux de discuter des options et des protocoles adaptés à vos projets de recherche spécifiques. Nous pouvons préparer des bibliothèques standard et spécialisées de divers types, y compris de l'ADN génomique avec des inserts de différentes tailles, des RNA-seq avec des options d'épuisement de Ribo ou de brins, la capture d'exome, ChIP-seq et microRNA-seq. Nous avons rationalisé et automatisé la préparation des bibliothèques et pouvons désormais générer jusqu'à 96 bibliothèques de codes-barres différentes à l'aide du IntegenX Apollo 324 robot et Etrier Sciclone G3 pour une qualité constante et un délai d'exécution rapide. Nous pouvons également fournir une formation et un accès aux robots si vous souhaitez utiliser vous-même les instruments pour des projets à grande échelle.

Le matériau de départ pour la construction de la bibliothèque Illumina est généralement de l'ADN double brin (ds) provenant de n'importe quelle source : ADN génomique, BAC, amplicons PCR, échantillons de puce, tout type d'ARN transformé en ADNc ds (ARNm, ARN total normalisé, ARNm), etc. à peu près tout ce à quoi vous pouvez penser qui finit ou peut être transformé en ADNdb. Cet ADNdb est ensuite fragmenté (s'il ne l'est pas déjà, comme dans ChIP). La longueur moyenne des fragments ne doit pas dépasser 600 pb (HiSeq 2500, MiSeq) ou 350 pb (HiSeq 3000). Ensuite, les extrémités sont réparées et mises en queue, les adaptateurs sont ligaturés, la sélection de la taille est effectuée, puis la PCR est effectuée pour générer la bibliothèque finale prête pour le séquençage. Différents types de bibliothèques peuvent varier dans les détails (comme une bibliothèque sans PCR), mais il s'agit du flux de travail de base. Un excellent forum pour les questions liées à la séquence de toutes sortes sur toutes les plateformes est le forum Seqanswers.com.

Quantification et pureté des échantillons d'ADN/ARN
Les quantités d'ADN et d'ARN d'entrée spécifiées ci-dessous et dans ce tableau s'appliquent si les échantillons sont quantifiés par une méthode fluorométrique (par exemple Qubit, PicoGreen, RiboGreen). La fluorométrie offre des avantages en termes de précision et de spécificité (par exemple, les colorants d'ADN ne se lieront pas à/ne mesureront pas l'ARN). Si un spectrophotomètre (par exemple Nanodrop) est utilisé, nous vous suggérons de soumettre le double de la quantité d'échantillon demandée car ce type de mesure est souvent peu fiable. Dans tous les cas, des quantités d'échantillons supérieures aux exigences minimales amélioreront la complexité de la bibliothèque. Les lectures du spectrophotomètre sont très utiles pour évaluer la pureté des échantillons. Pour les échantillons d'ADN, le rapport 260/280 doit être compris entre 1,8 et 2,0 et le rapport 260/230 doit être supérieur à 2,0. Pour les échantillons d'ARN, le rapport 260/280 doit être compris entre 1,8 et 2,1 et le rapport 260/230 doit être supérieur à 1,5. Les valeurs en dehors de ces plages indiquent une contamination. Le Core PCR en temps réel peut effectuer des extractions d'ADN ainsi que d'ARN.

Services de préparation de bibliothèque de séquençage : exemples d'exigences

Veuillez également consulter le tableau complet des exigences

Bibliothèques basées sur l'ADN

Les spécifications de performance des bibliothèques que nous produisons dépendent du matériel source. L'ADN génomique, les bibliothèques d'ADNc double brin, les BAC ou tout autre matériel disponible en quantités de microgrammes généreront des bibliothèques de qualité presque à chaque fois.

Lignes directrices pour la soumission d'ADN digne d'une bibliothèque
Fournir 2 ug ou plus d'ADN de haute qualité (concentration > 50 ng/ul, DO 260/280 proche de 1,8 260/230 ratio >2.0) dans un tampon EB ou TE (tampon EB de préférence), ou de l'eau de qualité biologie moléculaire. La construction d'une bibliothèque peut également être tentée à partir de moins de données d'entrée, avec des mises en garde. Si le matériel d'entrée total pour la préparation de la bibliothèque est inférieur à 100 ng, des protocoles spéciaux de préparation de la bibliothèque doivent être utilisés. Pour les bibliothèques sans PCR, des quantités d'échantillons de 5 ug d'ADN sont recommandées, il est possible de travailler avec moins.

Bibliothèques de puces
Nous proposons la construction de bibliothèques à partir de matériel immunoprécipité de chromatine. Pour ces expériences plus complexes, des discussions avec le personnel du noyau concernant l'adéquation du matériau de départ et la stratégie de construction sont recommandées. Aucune garantie n'est offerte avec ce service de bibliothèque, si ce n'est que nous ferons de notre mieux ! Pour le contexte général, la note technique ChIP-Seq Data et la fiche technique ChIP-Seq d'Illumina peuvent être intéressantes.

Bibliothèques de paires de compagnons
Le séquençage des bibliothèques Mate Pair génère des lectures appariées à insertion longue. Les bibliothèques sont générées par auto-ligature de longs fragments d'ADN et marquage des sites de jonction pour générer des molécules de bibliothèque chimériques qui rassemblent des séquences initialement distantes de 2 kb à 12 kb. Nous utilisons le kit Illumina Nextera Mate Pair qui utilise une enzyme transposase pour fragmenter et marquer l'ADN en une seule étape. Les tags sont biotinylés et permettent ainsi la sélection de sites de jonction contenant des fragments. Contrairement aux anciens protocoles de bibliothèque de paires de partenaires, le kit Nextera est très fiable à l'exception du dimensionnement des fragments initiaux. Comme pour toutes les autres analyses de fragments d'ADN longs, la qualité de l'ADN est importante. Veuillez nous envoyer une image de gel par e-mail avant de soumettre les échantillons d'ADN. Les échantillons doivent être exécutés sous forme de bande de 20 ko ou plus sur des gels d'agarose.
Le kit Nextera propose deux protocoles : la version “gel-free” (entrée 1 ug), qui est surtout intéressante lorsque peu d'ADN d'entrée est disponible. Les tailles des fragments de paires de partenaires de ce protocole varient généralement de 1,5 kb à 10 kb. Étonnamment, l'échafaudage SSPACE peut toujours fonctionner avec ces données.
La version “gel-plus” nécessite un minimum de 4 ug d'ADN d'entrée (et 4 fois les réactifs) et utilise des extractions sur gel pour sélectionner la taille des fragments dans une plage de +- 700 pb pour les compagnons plus courts et de +- 2 Ko pour les plus longs compagnons jusqu'à 10 à 12 ko. En raison des incertitudes de la fragmentation, veuillez soumettre au moins deux fois la quantité d'échantillon.
En théorie, les tailles de fragments résultant de la tagmentation ne dépendent que de la quantité d'ADN d'entrée. Dans la pratique, les longueurs des fragments varient considérablement entre différents échantillons d'ADN de quantités similaires. Cette variabilité entre les échantillons peut être observée même après une quantification précise de l'ADN par fluorométrie. Les réactions sont cependant réglables pour des aliquotes du même échantillon. Surtout si des plages de tailles très spécifiques sont souhaitées, il est souvent nécessaire de répéter la réaction de tagmentation avec des quantités d'ADN ajustées. Nous pourrions ensuite combiner des fractions d'extraction de gel de taille similaire à partir de deux réactions de tagmentation pour générer des bibliothèques de grande complexité pour les plages de tailles souhaitées. Veuillez nous faire savoir à quel point les gammes de tailles de plaquettes spécifiques sont importantes pour votre projet.
En raison des difficultés à prédire les plages de taille des fragments, nous citons les taux de recharge des paires de partenaires comprenant deux réactions de tagmentation. Si nous pouvons générer la bibliothèque souhaitée avec une seule balise, nous facturons le tarif le plus bas de la préparation de la bibliothèque à une seule balise.

Enrichissement de la cible
De nombreuses entreprises fournissent des services et des plateformes qui génèrent un exome entier ou une amplification de cible. Nous proposons le Fluidigm Access Array, qui utilise des nanofluidiques pour une sélection de cibles rentable afin de générer des bibliothèques d'amplicons à code-barres prêtes pour le séquençage Illumina. Bibliothèques de capture de séquence sont celles dans lesquelles des régions génomiques particulières sont enrichies après génération et séquençage de bibliothèques indexées. Cette stratégie permet un séquençage ciblé et très profond et peut être mise en œuvre pour un certain nombre d'applications. Plusieurs entreprises proposent des plates-formes capables de générer ce type de matériel, notamment Illumina, RainDance, Agilent, NimbleGen et Fluidigm. Des informations techniques sur les systèmes Agilent, Nimblegen, RainDance et Qiagen (qui utilisent une stratégie de capture basée sur la PCR, et non par hybridation, pour l'enrichissement) sont disponibles mais leur mise à jour n'est pas garantie. Considérez-les comme un point de départ pour une enquête plus approfondie (nous avons les coordonnées des représentants de l'entreprise si nécessaire) et uniquement à titre informatif (aucune approbation implicite, etc.).

Bibliothèques d'ARN-Seq

Quelque chose d'un terme impropre parce que toutes les bibliothèques finissent sous forme d'ADN, mais cela fait référence au matériel de départ. Nous proposons la préparation de bibliothèques d'ARN-seq, avec un certain nombre d'options telles que l'épuisement des ribo-ribos, l'enrichissement poly-A, des bibliothèques spécifiques aux brins comme décrit ci-dessous ainsi que des préparations de micro-ARN (miARN) et de petites bibliothèques d'ARN.

Guidelines for Submission of Library-Worthy RNA
Provide at least 1 ug (2 – 5 ug preferred) of total RNA at a concentration of at least 50 ng/ul (1 ug for Poly-A enrichment 2 ug for ribo-depletion libraries using less starting material is possible, but we can’t guarantee results). Please make sure that your RNA isolation protocol employs a DNAse digestion step or other means to remove DNA from the sample. On an agarose gel, DNA contamination will be visible as a smear of band of fragments considerably larger than the RNA (>10 kb). To verify the purity of the RNA samples the 260/280 ratio should be between 1.8 and 2.1 and 260/230 ratio should be higher than 1.5. Poly-A enrichment, ribo-depletion and strand specific library prep are among the commonly requested types of service (more technical details on this appear below). We suggest following the recommendations from Illumina – for human samples use total RNA with a bioanalyzer RIN score of 8 or better, for plant material RIN numbers can be lower and tissue-specific (this is mainly a function of the chloroplast content). Libraries for slightly degraded RNA samples should be prepared using ribo-depletion protocols. If possible please avoid RNA extraction protocols involving Trizol or related phenol containing reagents (silica column based kits are less likely to retain contaminants). If using Trizol, protocols that contain a column based cleanup (e.g. Direct-zol, TRIzolPlus) have to be used. Please note that an additional column cleanup is mandatory for RNA samples isolated from PAXgene tubes or with PAXgene kits. RNA samples should be eluted in molecular biology grade water, always stored in a -80 degree freezer and shipped on dry ice. Tous RNA samples require a Bioanalyzer sample QC (or equivalent). Such QC traces can be submitted by the customers or we can run the QC for a fee instead.

Poly-A Enrichment
Total RNA samples can contain up to 90% ribosomal RNA sequences, which are uninformative for transcriptome or gene expression studies, while mRNAs typically make up only 1 to 2% of total RNA. Thus the enrichment of samples for mRNAs is highly desirable. Poly-A enrichment is the most commonly used method to enrich mRNA sequences from eukaryotic total RNA samples mRNAs are selected by hybridization to poly-T oligos bound to magnetic beads.

Ribosomal RNA Depletion
There are multiple commercially available kits to remove ribosomal RNA from your total RNA. The main reason for rRNA depletion is to reduce highly abundant ribosomal RNA especially when transcripts do not carry polyA (bacterial RNA), and also when you desire to retain all long non-coding RNA (lncRNA) and polyA classes of RNA in your sample. Commercial kits containing rRNA removal solution are available for different types of total RNA they include human, mouse, rat, bacteria (gram positive or negative), plant leaf, plant seed and root, and yeast. Ribo depletion protocols can further enable the analysis of slightly degraded RNA samples. We ask for at least 2 ug of total RNA for the preparation ribo-depleted libraries. As always libraries can be generated from less material, but the complexity can suffer.

Micro RNA and Small RNA Libraries
We offer library construction for micro and small RNAs from total RNA using the Illumina protocol and reagents. We size select the libraries with high precision using the Blue Pippin system. The minimum recommended amount of total RNA required for these preps is 1 microgram (recommendations for humans samples). Since the total RNA composition can vary widely between tissues and organisms, please aim to provide at least 2 ug of total RNA. Please also take care that you RNA isolation method actually retains micro and small RNAs. The total RNA samples should be submitted in molecular biology grade water at a concentration of 200 ng/ul. High quality RNA is recommended (the total RNA samples should have RIN scores of 8 or higher according to a Bioanalyzer QC) and should have been DNAse treated before sample submission.

Strand-Specific RNA Libraries
By default we generate strand-specific RNA-seq libraries in the Core. Please let us know if you would prefer the traditional non-stranded library prep instead. Strand-specific (also known as stranded or directional) RNA-seq libraries substantially enhance the value of an RNA-seq experiment. They add information on the originating strand and thus can precisely delineate the boundaries of transcripts in regions with genes on opposite strands, and can determine the transcribed strand of non-coding RNAs. During the cDNA synthesis dUTP is incorporated in the second-stand synthesis. After adapter ligation the dUTP-containing strand is selectively degraded, to preserve strand information for RNA-seq. The forward read of the resulting sequencing data thus represents the “anti-sense strand” and the reverse read the “sense strand” of the genes (for Trinity transcriptome assemblies the “–RF” orientation flag should be used).

Other Library Considerations

PCR-Free Libraries
Libraries generated without amplification will reduce library prep biases. Thus, they can improve the sequencing coverage of genomic areas such as GC-rich regions, promoters, and repeat regions, and enhancing the detection of sequence variants. Please note that PCR-free libraries are more difficult to QC and quantify (please see the bottom of the page) and that the yields tend to be lower for these libraries compared to amplified libraries (10-15%). PCR-free library prep will also require a greater amount of starting material (>5 fold).

Indexed Libraries
Indexing, also called barcoding, allows for the sequencing of multiple libraries in a single lane, i.e., multiplexing. By default all libraries generated by us have a barcode. Multiplexing is required when the typical lane output of 15-25 million reads from the MiSeq, 120-180 million reads from the HiSeq 2500, or 260-310 million reads from the HiSeq 3000 is greater than required for a single library (e.g., in sequencing BACs, PCR generated fragments, small microbial genomes, transcriptomes, exome, ChIP, and small RNA applications). Multiplexing is also the best way to minimize potential lane-to-lane sequencing variation, as all of your samples are subject to the same sequencing conditions. For example, if you require two sequencing lanes for six samples we recommend 6-plexing and sequencing over two lanes, instead of 3-plexing per lane. The principle is that short nucleotide “barcodes” are appended to each library using specific adapters containing those sequences. Libraries containing different indexed adapters are then constructed, quantified, pooled in equimolar amounts, and sequenced. Deconvoluting the barcodes informatically allows multiple libraries to be sequenced in a single lane at a potential cost and time saving. To date, two methods have been exploited for this: using the commercially available indexing kits (Illumina TruSeq, Nextera, or Bioo Scientific) or synthesizing your own adapter oligos with your own barcodes. With the Illumina TruSeq v2 Library Prep Kits A and B you can use up to 24 different barcodes per kit to multiplex up to 48 libraries. Bioo Scientific offers Illumina-compatible barcodes (NEXTflex) with up to 96 barcodes. The Nextera kit (Epicentre/Illumina) uses dual indexing and transposon mediated fragmentation (‘tagmentation’) followed by PCR amplification to integrate barcoded adapters (so a PCR-free library is not an option using the Nextera kit). The dual indexing/adapter tagging strategy (with up to 12 indices available for adapter 1 and up to eight indices for adapter 2) permits up to 96 unique dual index combinations.

Homemade indexing has been used successfully by multiple users. Please avoid the “in-line” barcoding strategy and use Truseq or Nextera-style adapter designs instead (i.e. the barcodes are read in a separate read and do not interfere with cluster registration). It is important to ensure that the base composition of the indices are balanced to optimize the ability of the image analysis software to distinguish signals.

Libraries: Make Your Own

Library construction involves DNA fragmentation (if necessary, depending on the nature of the initial sample), enzymatic treatment of the DNA to repair and A-tail the fragments, ligation of sequencing adapters to these fragments, then subsequent PCR amplification (or skip this for PCR-free libraries), with or without size selection depending on the application. See below for more information on these various aspects of library construction. We also offer Next-Gen Library Prep Training Workshop for comprehensive hands-on training on how to prepare high quality libraries for Illumina sequencing.

Fragmentation
DNA to be made into a sequencing library must first be converted into small fragments. The average insert length should not exceed 600 bp (HiSeq 2500, MiSeq) or 350 bp (HiSeq 3000). There are several methods for doing this, each with attendant pros and cons. Many protocols and centers rely on and recommend a fragmentation device from Covaris, which uses adaptive focused acoustics to break the DNA into appropriately sized fragments. The Covaris E220 can meet the demands of high throughput library production. We primarily use a Covaris E220 and Diagenode Bioruptor NGS (or Bioruptor UCD-200). Access to these instruments is available through the Core, with the usual training and sign up guidelines for Core-available equipment in effect.

Basic DNA and RNA Library Protocols
We use library kits from Illumina, Wafergen, Kapa Biosystems, Bioo Scientific, CloneTech, and NuGen as a source of the fragment repair, tailing, and amplification enzymes. There are a number of other next-gen related products currently being used in the research community. For mRNA-seq libraries we are currently using the stranded Illumina kit. New products are out there and we encourage you to do research if RNA-seq libraries are of interest. In particular, ribosomal RNA depletion protocols that integrate with Illumina kit, and novel RNA amplification and library production resources from NuGen and CloneTech, have expanded the services we offer and will no doubt continue to do so. In other words, keep checking this site to see how things evolve.

The Illumina Adapter Oligonucleotides
The oligonucleotide sequences of the Illumina adapters are available ici . Illumina tends to sell their adapters only in conjunction with library prep kits. Other vendors of fully compatible ready-to-go adapters include Bioo Scientific. Custom synthesis from companies like MWG-Eurofins, Bioneer, and IDT is another valid option. Two things to note – the “top” Indexed adapter (starting with GATC) must be phosphorylated, and the “bottom” Universal adapter can be synthesized with a special linkage between the 3′ terminal T and the preceding C. This phosphorothioate linkage renders the overhanging T (after annealing the top and bottom adapter oligos) more nuclease resistant, diminishing the probability of adapter dimers (more on adapter dimers below).

Libraries: Quality Control (QC)

Library quality is the single most important determinant of the success of your sequencing run, both in terms of the number of reads generated (quantification) and the validity of the sequence obtained (content). Methods for construction and analysis continue to evolve while now somewhat dated a useful early paper by Quail et al. from the Sanger Institute lists a number of improvements over the standard Illumina protocols in library preparation and analysis. If you construct your own libraries you may want to download this paper and a supplementary methods table for the many practical issues covered. We carry out two QC measures on all libraries sequenced in our Core – examination on the Agilent Bioanalyzer, and quantification using the Kapa Biosystems Illumina Library Quantification Kit.

The Bioanalyzer provides a detailed visual examination of the libraries. The “perfect” library electropherogram, pictured here, shows a single peak of the expected molecular weight. Common additional forms include primer dimers (at around 80-85 bases), adapter dimers (around 120 bases), and broader bands of higher MW than the expected peak. Primer dimers, minimized by the use of magnetic beads, are not a problem unless they completely dominate the reaction. Adapter dimers can be a problem because they will sequence much more efficiently. As a result, whatever the proportion of adapter dimers in your library will be seen as an even higher percentage of reads in your final data files. Adapter dimers can be minimized by adjusting the adapter:insert ratio during library construction and exercising care in gel extraction or other size selection steps. The larger MW, typically more hump-shaped forms that are visualized on the Bioanalyzer are probably a result of excess amplification during the final PCR step. While some amount of these are tolerable, if they are too prominent then the library should be re-amplified from the gel extracted material.

We use a qPCR assay for library quantification – the Kapa Biosystems qPCR assay is run on all the libraries we sequence (and is included in the sequencing price). This has allowed us to provide much more consistent cluster values, which translates to more consistent read numbers. For long runs in particular it’s essential to maximize the data recovered given the time and money involved, which is why we recommend this quantification so strongly.

Library Requirements, Submission, and Storage

Submission
We must receive electronic ([email protected]) and print copies (submitted together with samples) of the appropriate submission form. All customer submitted libraries should be accompanied by Bioanalyzer (or similar) traces. If no traces are submitted we will carry out the Bioanalyzer analysis for a fee. Please visit the Sample Submission & Scheduling page to download submission forms and for more detailed instructions. The same form is currently used for both library preparation and library sequencing submissions. Please contact us if you have any questions about the required information it is essential that you fill in all the information to minimize the chance for error on these expensive and time consuming experiments. One thing we need to know is the approximate insert size desired in the absence of specific preferences we recommend about 220 bp for most mRNA and DNA libraries, but insert sizes should be larger for the longer read MiSeq runs. For certain applications, such as de novo assembly, a range of sizes may be desired and we can accommodate that. But again, we strongly recommend verifying the suitability of these values for the experiment you are trying to do.

Sequencing Library Requirements
The standard requirements for library submission are at least 15 ul volume at a concentration of 5 nM (e.g., 2.3 ng/ul given a 700 bp library). More volume and/or higher concentration is welcome. We can work with less library (down to 1 nM), but the quantification becomes less reproducible, the library becomes less stable, and relatively larger amounts of library DNA stick to the sides of the storage tube. Lower sequencing yield is the likely outcome for library concentrations 1 nM or less, and we cannot guarantee the data quantity or quality for such libraries. The best buffer to ​store and submit libraries is 10 mM Tris​/0.01% Tween-20 ph=8.0 or 8.4​, but EB buffer is also acceptable​​. If possible ​please use 0.6 ml or 1.5 ml low-bind tubes. If you do not provide a Bioanalyzer trace (or equivalent) of your library, we will do this for a fee. Please note, the DNA insert size(s) should not exceed 700 bp and most Illumina adapters add about 120 bases to the fragment length as observed on the Bioanalyzer. When submitting your libraries for sequencing, please use our Illumina Sequencing Submission Form (hard copy with samples, and email to [email protected]), provide the Bioanalyzer profile, library prep methods, and index sequences used. We will measure the quantity of your libraries using real-time PCR (included in the sequencing price).

Libraries for HiSeq 3000 sequencing – The latest generation of sequencers has more stringent library requirements and requires higher library concentrations. The average insert size should ideally be 350 bp and the “tail” of longer fragments should not exceed 550 bp. The new clustering chemistry is more sensitive to adapter dimers: a 5% adapter-dimer contamination can result in 60% of the reads coming from these dimers. Thus it is very important that there is no indication of an adapter-dimer peak (around 120 bp) on the Bioanalyzer trace. Our preferred requirements for library submission are for at least 15 ul volume of 5 nM concentration (e.g., 1.6 ng/ul given a 470 bp library). More volume and/or higher concentration is welcome. Lower sequencing yield is the likely outcome for library concentrations 2 nM or less, and we cannot guarantee the data quantity or quality for such libraries.

PCR-free Libraries QC – The quality of these libraries is difficult to assess. The adapters of these libraries are partly single-stranded. Thus they tend to migrate slower than the fully double-stranded amplified libraries on the Bioanalyzer. In most cases the libraries appear to be 70 to 100 nt longer than they actually are – however the bioanalyzer traces can also be off by far larger margins (e.g. 500 bases). To be sure about the actual library fragment lengths we highly recommend to PCR-amplify an aliquot (1 ul) of the libraries with 8 PCR cycles and run both the PCR-free and the amplified sample on the Bioanalyzer. If multiple PCR-free libraries will be pooled, you might consider quantifying the individual libraries by qPCR before pooling.

Custom Sequencing Primers Please note that these are used only for a small minority of sequencing projects. Custom sequencing primers need to be submitted at a concentration of 100 uM and a volume of 20 ul each together with the libraries. Please make sure that the sequencing primer design fits the chosen Illumina platform. Miseq and Hiseq platforms use different annealing temperatures.

Planification
Once your library, or library raw material, is ready, you should deliver it as soon as possible to get the next available slot in the queue. Runs occur as we fill up the two (rapid mode) or eight (high-output mode) lanes on a HiSeq flow cell, and the timing on this can vary depending on service type and Core activity. For MiSeq runs the turnaround time is typically five to eight days, while you should allow three to five weeks for HiSeq sequencing in both cases allow an extra one to two weeks for library prep. The HiSeq sequencing scheduling calendar is now available on our website.

Sample/Library Storage Policy
Please let us know if you would like to pick up your samples/libraries after they have been sequenced and we will be happy to accommodate you otherwise, due to space limitations, they will be stored for only six months after sequencing runs have been completed.


Understanding Illumina Adapters - Biology

Sequencing random fragments of DNA is possible via the addition of short nucleotide sequences which allow any DNA fragment to:

  1. Bind to a flow cell for next generation sequencing
  2. Allow for PCR enrichment of adapter ligated DNA fragments only
  3. Allow for indexing or 'barcoding' of samples so multiple DNA libraries can be mixed together into 1 sequencing lane (known as multiplexing)

During library preparation each DNA fragment gets and addional A overhang added to both ends.

The sequencing adapters are the following:

The stars indicate a phosphorothioate bond between the last C and T to prevent cleaving off the last T that is needed for annealing the overhang. The phosphate group on the indexed adapter is required to ligate the adapter to the DNA fragment.

The NNNNNN in the indexed adapter above represents the barcode. Reverse the indexed adapter and note how the last 12 bases are complementary.

Once ligated to a DNA fragment the following arrangement will occur. Left side of the fragment will be:

The right side of the fragment will contain

Both ends before and after the annealed part are "floppy", hanging off.

The PCR Primer 1.0 is identical to the first 44 bases of the TrueSeq Adapter

The PCR Primer 2.0 is the reverse complement of the last 24 bases of the Indexed Adapter

The resulting PCR product will look like this for both strands:

where U stands for the Trueseq Adapter, S stands for DNA sequence that is to be sequenced and I stands for the Trueseq Indexed Adapter. The U will bind to the flowcell.

It is important to remeber that the S sequence could originate from both strands but the sequencing will only process reads that have a the U on the forward strand.

Created by Istvan Albert &bull Last updated on Thursday, December 11, 2014 &bull Site powered by PyBlue


Voir la vidéo: Illumina Sequencing by Synthesis (Août 2022).